Genome Coordinates

GA4GH Recommendation

• We recommends the use of “0-start, half-open” (interbase) coordinate system in all systems
• This is not a retrospective recommendation for existing standards and products
• “1-start, fully-closed” should be used when displaying coordinates through a GUI or report

Contributors

• @andrewyatz

Definition

Two integers that define the start and end positions of a range of residues, possibly with length zero, and specified using “0-start, half-open” coordinates.

The following also applies to coordinates:

• Coordinates start at 0 and finish at the length of the sequence
• Start must be greater than 0
• End must be greater than the start
• The length of an interval is (end - start)
• The reverse start is (sequence length - end)
• The reverse end is (sequence length - (start-1))
• A zero-length interval (start == end) is a point between two residues
• An interval of length 1 is a residue position
• Two intervals are equal if their start and end are equal
• Two intervals intersect if start or end occurs between the start and end of the other
• Two intervals coincide if they intersect or if they are equal

Model

• start (int): start position >= 0 (required)
• end (int): end position >= start (required)

Circular coordinates

Circular regions are not considered to be part of GA4GH and not covered here, since human genome data is handled as linear sequence. APIs may choose to support a circular location but must still support “0-start, half-open” coordinates.

Alternative names

The “0-start, half-open” scheme is also know by the following names:

• “0-based, half-open”
• Interbase
• UCSC style
• Chado style

All of these names refer to identical representations of coordinates. Interbase has a different interpretation of the representation useful when considering insertion events. Care should be taken when using these alterative names as they combine representation and interpretation.

How “0-start, half-open” works

         G A G T G C
 G G T G G A G T G C G C C G C C A T G G
                    1 1 1 1 1 1 1 1 1 1 2
0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0

“0-start, half-open” breaks down into two integer positions. The first, “0-start”, refers to the start coordinate and uses an indexing scheme starting at 0 to refer to bases within a sequence, similar to array indexes in most C based programming languages. The second, “half-open”, refers to the end coordinate and is one higher than the start (effectively using an indexing system starting at 1).

This scheme makes sub-sequences very easy to define. In the above example we have highlighted the subsequence GAGTGC, which starts at position 4 and ends at position 10. Calculating the length of this subsequence is easily done by subtracting start from end e.g. (10-4) = 6. Other transformations are less prone to programming errors than the alternative system “1-start, fully-closed”.

This same coordinate system can be used to flag insertions and deletions as a start and an end which equal each other refers to a space between two residues e.g. 4,4 would flag an event occurring between GGTG and GAGTGC.

What is “1-start, fully-closed”?

    GAGTGC
GGTGGAGTGCGCCGCCATGG
         11111111112
12345678901234567890

“1-start, fully-closed” is the human readable coordinate system used in all genomic data displays and reports. It indexes sequences starting at 1. This system should be used when displaying genomic data to a human because it is the correct way to refer to positions. The subsequence GAGTGC in “1-start, fully-closed” starts at position 5 and ends at position 10. Length is calculated by subtracting start from end plus one e.g. ((10+1)-5) = 6.

GA4GH Products and their coordinate systems

Not all GA4GH related products, specifications and APIs use the same system for their coordinates. Refer to the table below for full details.

Further Reading

• the documentation of the Variant object for the original GA4GH schema and the discussions that led to it: #49 and #121.
• a nice explanation of coordinate systems at Biostars.org by Obi Griffith
• Chado Interbase documentation
• Interbase primer
• Beacon’s support for coordinate systems
• Refget’s support for coordinate systems
• UCSC information on “0-start, half-open”
• Transforming between coordinates in “0-start, half open”